Ecology - Biodiversity & Conservation Questions and Answers
Biology
Ecology - Biodiversity & ConservationEach of the following is fermentation products except acetyl CoA lactate propionate OO ethanol Question 10 0 5 points Listen Why are mitochondria so prevalent in skeletal muscle Mitochondria provide the muscle elasticity to contract More mitochondria are required in tissues where blood flow is restricted Mitochondria provide energy for muscle contraction
Biology
Ecology - Biodiversity & ConservationOwas isolated from an ancient meoterite sample found in Australia is a virus that infects other viruses O is the first virus found to replicate outside of a host cell O is hypothesized to be the ancestor to all other viruses Question 4 Icosahedral capsids are only found in Giant viruses because the complexity of the capsid requires a minimum of 80 genes to constru O True False Question 5 The coccolithovirus can cause algal blooms by infecting and ultimately killing the primary competitors of marine algae
Biology
Ecology - Biodiversity & ConservationYou are asked to subclone the T7 RNA polymerase in the PGEX 4T 3 vector Which of the following forward primers should you use to PCR amplify your T7 RNA polymerase On the primer sequence the restriction recognition site is underlined and the starting ATG of the T7 RNA polymerase is shown in bold Restriction sites are shown in brackets in the pGEX4T 3 schematic PGEX 4T 3 Thrombin Leu Val Pro Arg Gly Serl Pro Asn Ser Arg Val Asp Ser Ser Gly Arg Ile Val Thr Asp CTG GTT CCG CGT GGA TCC CCG AAT TCC CGG GTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA t 4 BamHI EcoRI Sall Smal Xhol Notl Stop codons TAATAGGATCCATGAACACGATTAACATCGCTAAG BamHI TAATAGCGGCCGCTGAATGAACACGATTAACATCGCTAAG Notl TAATAGAATTCATGAACACGATTAACATCGCTAAG EcORI TAATACTCGAGCGATGAACACGATTAACATCGCTAAG Xhol TAATANCOCOCCINTCANCACCATTAACATCOSINAC ISmall
Biology
Ecology - Biodiversity & Conservation5 Which of the following are unlikely to grow on Simmons citrate agar Select all that apply a E coli b S flexneri c A bacterium that requires an inorganic nitrogen source d A bacterium that lacks citrate permease e E aerogenes 21
Biology
Ecology - Biodiversity & Conservation31 Which of the following is a inverse PCR method A using primers with 1 bp change to generate mutations no B using primers with restriction enzyme sequences adapter on the 5 end using primers that sequence outwards to obtain upstream and downstream sequence none of the above D
Biology
Ecology - Biodiversity & ConservationPREDICTION 0 Atmosphere no 02 more CO2 Earliest 2 1 F Atmosphere more 02 less COZI ON B Haceral Cell Prokaryote Multicellutar Plant Energy Competition Chemoautotrophie Anaerobic Bacteria 3 Multicellular Animal Ocean of Molecules 12 AHME RNA 4 A 5 H C Cyanobacteria M sen 6 7 D GD H 1 Organic molecules N Prediction Provide a justification for your group s sequence of events HISTORY OF LIFE ON EARTH 8 H L E Unicellular Eukaryote 9 J Big Bang How did you know which cards to place first S the beginning BID bang What is the reason you placed the cards on the latest end Bis the latest beca 10 I 11 up you will first make a prediction about the sequence of events by placing the environment and organism cards along the timeline poster provided by the teacher Place earlier events on the left hand side of the timeline and later events on the right hand side Provide a justification for your choices in the space below 3 12 13 JE of the anivers e 14 Latest 15 F 3 Animal is Latest new to the world ar Which cards are you most uncertain about their placement everything comes First then s What questions do you now have
Biology
Ecology - Biodiversity & ConservationDNA Replication Labeling with word bank DNA polymerase 5 DNA Ligase Okazaki fragment DNA Primase Single Strand Binding Leading Strand Lagging Proteins Strand 5 3 Helicase RNA primer OTTY Mys Ox 3 5 Topoisomerase
Biology
Ecology - Biodiversity & ConservationCellular respiratio Oxygen in CO Oxidative phosphorylation trix Inner mitochondrial membrane Matrix Recreate the order of the flow of electrons through oxidative phosphorylation from the electron donor to the terminal acceptor Start by clicking the first item in the sequence or dragging it here Drag the items below into the box above in the correct order starting with the first item in the sequence Electrons are donated to oxygen Protein complexes accept electrons and also pump protons across the mitochondrial membrane
Biology
Ecology - Biodiversity & Conservation11 Anyone that is at least sixteen years old that is employed or that is actively looking for a job A person that has given up looking for a job Is when people change jobs or looking for their first 12 13 job 14 The percentage of people that are in the labor force who want to work but can t find a job 15 When people become unemployed because they lack certain skills or education The supply and demand of jobs in the economy 16
Biology
Ecology - Biodiversity & ConservationWhich of the following is NOT one of the 4 basic elements of all living things Hydrogen Oxygen Carbon Potassium Question 9 1 point
Biology
Ecology - Biodiversity & Conservationhttps commons wikimedia org wiki File TransOceanus TedicuitC CE gr2 png a Toda Macrobia century trade and communications made this an early example of which of the following choices Choose the BEST answer increased O A trade route O Global integration Transportation of goods and services
Biology
Ecology - Biodiversity & ConservationA sponge has the following only cells no tissues Ono gut cavity a blastocoel a coelom Da blastopore is formed during development Question 41 1 point Listen Arthropods have metameres and a bilateral body symmetry O True False
Biology
Ecology - Biodiversity & Conservationaltitude it is covered with snow What is the central idea of this paragraph O Everest is always covered with snow Mount Everest is the highest peak in the world The altitude of Mount Everest is not significant Mount Everest can be measured
Biology
Ecology - Biodiversity & ConservationWhich figure of speech is used in the phrase Cute as a bug Metaphor O Simile O Personification Hyperbole
Biology
Ecology - Biodiversity & ConservationIdentify the figure of speech used in the expression He is a tiger in the boxing ring O Idiom O Metaphor O Hyperbole
Biology
Ecology - Biodiversity & ConservationWhat is onomatopoeia It is the representation of a place event literary work myth or work of art either directly or by implication It is an expression peculiar to a particular language that means something different from the literal meaning of the words It refers to words that imitate the sound they denote It is the fallacy of attributing inanimate O human feelings to
Biology
Ecology - Biodiversity & ConservationWhat does a cakewalk mean in the sentence below Last year the match was a cakewalk for her but this year I believe there is stiff competition O Easy O Tough O Walking cake
Biology
Ecology - Biodiversity & Conservationvolume of forgotten lore While I nodded nearly napping suddenly there came a tapping As of some one gently rapping rapping at my chamber door Tis some visitor I muttered tapping at my chamber door more Only this and nothing Find the figure of speech used in the lines above O Personification O Metaphor O Alliteration
Biology
Ecology - Biodiversity & ConservationSelect all that apply Choose all general assumptions made by scientists The universe s fundamental properties have not changed since its inceptio All natural forces acting now have always acted The fundamental nature of the Universe is in constant flux The Universe can never be completely described 1 1 O
Biology
Ecology - Biodiversity & ConservationChoose the correct answer In Greek dramas the role of the O protagonist O antagonist O confidant O None of the choices was awarded to the best actor
Biology
Ecology - Biodiversity & ConservationWhich of the following is NOT a belief of Transcendentalists O Everything in the world is a reflection of the divine soul O Intuition gives one an understanding of right and wrong O Having personal belongings is more important than having other things O The natural world is a doorway to the spiritual world
Biology
Ecology - Biodiversity & ConservationQuestion 64 Choose the correct answer to complete the statement A simile is Points 1 O an exaggeration or overstatement O a comparison of two unlike things a statement with restraint to emphasize what is being talked about O a term for an often repeated idea or theme in literature
Biology
Ecology - Biodiversity & ConservationWhy is this a bad example of the visual strategy Mutualism is a biological interaction between two species wherein both the species benefit from each other O The definition is incorrect The picture is not unexpected or funny so you won t really remember it The image came from google
Biology
Ecology - Biodiversity & ConservationWhy do you think the title of Achebe s novel is Things Fall Apart The novel describes the end of harvest season The novel describes the O breakdown of a man and his society The novel describes a natural disaster All of the choices
Biology
Ecology - Biodiversity & ConservationWhat was the purpose of the passage of the Title IX Act Ensure that there is no discrimination in women s collegiate athletes O Avoid discrimination is based on race on college campuses O Avoid discrimination based on age of collegiate O Avoid discrimination based on class
Biology
Ecology - Biodiversity & ConservationWhat was the hardest part of the experience for poor immigrants crossing the Atlantic Ocean O Traveling in steerage O Being homesick Being forced to do hard labor O Leaving their families in their home countries Questic 1 5 9 13 17 21
Biology
Ecology - Biodiversity & ConservationQuestion 3 Points 1 Also known as the Unequal Treaties this protocol was signed with China after the failure of the Boxer Rebellion Chinese Protocol Boxer Protocol Eastern Protocol O Unequal Protocol Complete Later Complete Reset Reset butte this assess Reset Questions 9
Biology
Ecology - Biodiversity & ConservationThe repuration daytoy were hoch They were The Gruppe were are that the army was bases d OUS e disband may forever 6
Biology
Ecology - Biodiversity & ConservationQuestion 10 of 10 Which two examples would likely result in a decrease in biodiversity A A sudden shift in conditions that a species lacks adaptations to survive B The speciation of squirrel populations separated by a geographic barrier C The extinction of a species of eucalyptus tree due to forest fires D Slow changes to a habitat that cause divergence in forest populations SUBMIT
Biology
Ecology - Biodiversity & ConservationMatch the tissue type with its function protection from wear and tear supports and binds other tissues can act as a water reservoir filtration and exchange of substances via diffusion absorption and secretion withstand high tension and stretching particularly in one direction 1 Simple squamous epithelium 2 Simple columnar epithelium 3 Stratified squamous epithelium 4 Dense regular connective tissue 5 Areolar connective tissue
Biology
Ecology - Biodiversity & Conservationdentify what humans can do to minimize the impact of urban sprawl on wildlife
Biology
Ecology - Biodiversity & Conservation18 Which of the following environmental features might influence microclin O forest canopy Ofreshly plowed field log on the forest floor Olarge boulder of the options are correct
Biology
Ecology - Biodiversity & Conservationtollowing terms with their descriptions The smaller branch of a spinal nerve that innervates the posterior body trunk The connection between the spinal cord and a spinal nerve containing sensory fibers The connection between the spinal cord and a spinal nerve containing motor fibers The larger branch of a spinal nerve that innervates the anterior and lateral trunk and limbs 1 Dorsal rami 2 Dorsal roots 3 Ventral rami 4 Ventral roots
Biology
Ecology - Biodiversity & Conservation24 Why are drinking water supplies still a major concern for many countries
Biology
Ecology - Biodiversity & ConservationPatterns in biogeography have revealed that species that share more recen common ancestors also tend to have which two features A They are separated by a greater geographical distance B They are biologically more similar to each other C They are geographically closer to each other D They are biologically more different from each other
Biology
Ecology - Biodiversity & ConservationHumans and gorillas have one amino acid difference in their hemoglobin sequences What does this say about the evolutionary relationship of these two species O A Gorillas recently evolved from humans B They have no common ancestors C They probably have a recent common ancestor D They are probably the same species
Biology
Ecology - Biodiversity & ConservationWhich of the following statements is most likely true of a protein that cotransports glucose and sodium ions into the intestinal cells of an animal A substance that blocks sodium ions from binding to the cotransport protein will also block the transport of glucose Sodium and glucose compete for the same binding site in the cotransporter Glucose entering the cell down its concentration gradient provides energy for uptake of sodium ions against the electrochemical gradient Sodium ions can move down their electrochemical gradient through the cotransporter whether or not glucose is present outside the cell
Biology
Ecology - Biodiversity & ConservationMovement of molecules and organelles occurs in both directions anterograde and retrograde They generate graded potentials They generate nerve impulses They have many rough ER and Golgi apparatus organelles as they are active in biosynthesis Question 26 2 points 4 Listen Satellite cells function is similar to Schwann cells O astrocytes oligodendrocytes
Biology
Ecology - Biodiversity & ConservationWhich group of fungi include species that are responsible for the recent decline in multiple frog species Oyeasts Ascomycota Chytrids Basidiomycota Zygomycota
Biology
Ecology - Biodiversity & ConservationRegeneration repair Regeneration fibrosis Restoration striae Mitosis inflammation Question 38 2 points 4 Listen The first step in tissue repair involves replaces it with scar tissue proliferation of fibrous connective tissue inflammation formation of scar tissue
Biology
Ecology - Biodiversity & ConservationA plant is green because it green light A refracts C absorbs B reflects D transforms
Biology
Ecology - Biodiversity & ConservationIh which area of the diagram is most of Earth s phosphorus stor CVDL X O A W B X Phosphorous Cycle W Runoff Sediment Guano Mining Rock weathering Organic animal wastes Z Decomposers Y Land formation
Biology
Ecology - Biodiversity & ConservationThe house fly can serve as a mechanical vector of many parasitic pathogens or eggs thereof The terms phoresis and paratenic both can be used to describe a house fly participating in this behavior Use these terms in A SINGLE SENTENCE to describe the relationship a house fly might have with Entamoeba coli
Biology
Ecology - Biodiversity & ConservationIn a parasitic symbiosis one species lives another species A in the same habitat as C on or in B nearby D harmoniously with
Biology
Ecology - Biodiversity & Conservationis a symbiotic relationship in which one species benefits and the other neither gains nor loses anything A Mutualism C Commensalism B Co habitism D Parasitism
Biology
Ecology - Biodiversity & ConservationA typical pioneer species is a n that can breakdown rock to form an area conducive to more diverse forms of life A hearty autotroph C keystone chemotroph B hearty heterotroph D obligate anaerobe
Biology
Ecology - Biodiversity & ConservationWhich organisms are considered predators omnivores Odetritivores Oscavengers carnivores herbivores decomposers