Question:

Transcription and Translation Practice Worksheet Example: DNA: GTACGCGTATACCGACATTC mRNA: CAUGCGCAUAUGG CUGUAAG Codons: AUG-CGC-

Transcription and Translation
Practice Worksheet
Example:
DNA:
GTACGCGTATACCGACATTC
mRNA:
CAUGCGCAUAUGG CUGUAAG
Codons:
AUG-CGC-AUA-UGG-CUG-UAA
Anticodons: UAC-GCG-UAU-ACC-GAC-AUU
Amino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINE
Using the example above, transcribe the following DNA strand into mRNA and translate that
strand into a polypeptide chain, identifying the codons, anticodons, and amino acid
sequence.
DNA: ATACGA AATCGCGATCGCGGCGATTCGG
1.
mRNA: UAGC LUUAGGECUAGCGCCGCUAAGCC
Codon: GU
Anticodon:
Amino Acids:
2. DNA: TTTACGGCCATCAGGCAATACTGG
mRNA:
Codon:
Anitcodon:
Amino Acids:

Transcription and Translation Practice Worksheet Example: DNA: GTACGCGTATACCGACATTC mRNA: CAUGCGCAUAUGG CUGUAAG Codons: AUG-CGC-AUA-UGG-CUG-UAA Anticodons: UAC-GCG-UAU-ACC-GAC-AUU Amino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINE Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: ATACGA AATCGCGATCGCGGCGATTCGG 1. mRNA: UAGC LUUAGGECUAGCGCCGCUAAGCC Codon: GU Anticodon: Amino Acids: 2. DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids: