Question:

Transcription and Translation Practice Worksheet Example: DNA: GTACGCGTATACCGACATTC mRNA: CAUGCGCAUAUGG CUGUAAG Codons: AUG-CGC-

Transcription and Translation Practice Worksheet Example: DNA: GTACGCGTATACCGACATTC mRNA: CAUGCGCAUAUGG CUGUAAG Codons: AUG-CGC-AUA-UGG-CUG-UAA Anticodons: UAC-GCG-UAU-ACC-GAC-AUU Amino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINE Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: ATACGA AATCGCGATCGCGGCGATTCGG 1. mRNA: UAGC LUUAGGECUAGCGCCGCUAAGCC Codon: GU Anticodon: Amino Acids: 2. DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids:

Transcription and Translation Practice Worksheet Example: DNA: GTACGCGTATACCGACATTC mRNA: CAUGCGCAUAUGG CUGUAAG Codons: AUG-CGC-AUA-UGG-CUG-UAA Anticodons: UAC-GCG-UAU-ACC-GAC-AUU Amino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINE Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: ATACGA AATCGCGATCGCGGCGATTCGG 1. mRNA: UAGC LUUAGGECUAGCGCCGCUAAGCC Codon: GU Anticodon: Amino Acids: 2. DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids:

< PreviousNext >

More Questions on Biomolecules

View all
Genes define traits, while alleles are (Select the best answer) Different forms of different genes, determining how the trait is expressed, Different forms of the same gene, determining how the trait is expressed. Similar forms of different genes, determin

Biology

Biomolecules Solutions

Genes define traits, while alleles are (Select the best answer) Different forms of different genes, determining how the trait is expressed, Different forms of the same gene, determining how the trait is expressed. Similar forms of different genes, determining how the trait is passed from parent to offspring, Very similar forms of the same gene, determining how traits are passed on from parent to offspring, 000

IIAS ASSIGNMENTS COURSES Assignment - 7. Proteins, Enzymes, and Nucleic Acids Attempt 1 01100 A < 1 2 3 4 5 6 7 8 9 10 11 Select all that apply. Which of the following chemicals are proteins? O antibodies starch polysaccharides enzymes nuclele acids

Biology

Biomolecules Solutions

IIAS ASSIGNMENTS COURSES Assignment - 7. Proteins, Enzymes, and Nucleic Acids Attempt 1 01100 A < 1 2 3 4 5 6 7 8 9 10 11 Select all that apply. Which of the following chemicals are proteins? O antibodies starch polysaccharides enzymes nuclele acids

Question 8 (1 point) A 12 g sample of sugar cubes is being dissolved in 100 mL of water. Which of the following would speed up the rate of dissolving the sugar cubes? stir the solution crush the sugar cubes raise the temperature of the solution O all of th

Organic Chemistry

Biomolecules Solutions

Question 8 (1 point) A 12 g sample of sugar cubes is being dissolved in 100 mL of water. Which of the following would speed up the rate of dissolving the sugar cubes? stir the solution crush the sugar cubes raise the temperature of the solution O all of these would speed up the rate