Biomolecules Questions

In the salvage of purines, hypoxanthine-guanine phosphoribosyltransferase (HGPRT) is responsible for which of the following processes?
A) Conversion of hypoxanthine to xanthine.
B) Conversion of guanine to guanosine monophosphate (GMP).
C) Conversion

Biology

Biomolecules Solutions

In the salvage of purines, hypoxanthine-guanine phosphoribosyltransferase (HGPRT) is responsible for which of the following processes? A) Conversion of hypoxanthine to xanthine. B) Conversion of guanine to guanosine monophosphate (GMP). C) Conversion of adenine to adenosine monophosphate (AMP). D) Conversion of inosine monophosphate to inosine.

All are reasons to monitor therapeutic drugs EXCEPT:
A) serious consequences from overdosing.
B) unpredictable blood levels.
C) monitor patient compliance.
D) large difference between therapeutic and toxic dose.

Biology

Biomolecules Solutions

All are reasons to monitor therapeutic drugs EXCEPT: A) serious consequences from overdosing. B) unpredictable blood levels. C) monitor patient compliance. D) large difference between therapeutic and toxic dose.

How are fatty acids transported to the cells for B-oxidation?
A. they are carried by albumin
B. they are transported in LDL particles
C. they are only degraded in the liver and are not transported
D. they are bound to and carried by carnitine
E. they

Biology

Biomolecules Solutions

How are fatty acids transported to the cells for B-oxidation? A. they are carried by albumin B. they are transported in LDL particles C. they are only degraded in the liver and are not transported D. they are bound to and carried by carnitine E. they are bound to and carried by a CoA molecule

Hector is back from his morning run and is feeling lightheaded because his energy is depleted. Which food item will provide him with a quick source of carbohydrates?
A. fruit juice
B. Tuna fish
C. scrambled eggs and butter
D. beans

Biology

Biomolecules Solutions

Hector is back from his morning run and is feeling lightheaded because his energy is depleted. Which food item will provide him with a quick source of carbohydrates? A. fruit juice B. Tuna fish C. scrambled eggs and butter D. beans

What is the purpose of this section of text?
A. To contrast how different people used sugar
B. To explain sugar cane's ceremonial purpose
C. To compare sugar cane use to honey use
D. To provide the history of sugar cane use

Biology

Biomolecules Solutions

What is the purpose of this section of text? A. To contrast how different people used sugar B. To explain sugar cane's ceremonial purpose C. To compare sugar cane use to honey use D. To provide the history of sugar cane use

Transcription and Translation
Practice Worksheet
Example:
DNA:
GTACGCGTATACCGACATTC
mRNA:
CAUGCGCAUAUGG CUGUAAG
Codons:
AUG-CGC-AUA-UGG-CUG-UAA
Anticodons: UAC-GCG-UAU-ACC-GAC-AUU
Amino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINE
Using the exa

Biology

Biomolecules Solutions

Transcription and Translation Practice Worksheet Example: DNA: GTACGCGTATACCGACATTC mRNA: CAUGCGCAUAUGG CUGUAAG Codons: AUG-CGC-AUA-UGG-CUG-UAA Anticodons: UAC-GCG-UAU-ACC-GAC-AUU Amino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINE Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: ATACGA AATCGCGATCGCGGCGATTCGG 1. mRNA: UAGC LUUAGGECUAGCGCCGCUAAGCC Codon: GU Anticodon: Amino Acids: 2. DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids:

Which of these best describes a partial agonist?
O its effects differ depending on the concentration
of the neurotransmitter in question
O it acts as both an agonist and an antagonist at the
exact same time for the exact same synapse
O it always has the sa

Biology

Biomolecules Solutions

Which of these best describes a partial agonist? O its effects differ depending on the concentration of the neurotransmitter in question O it acts as both an agonist and an antagonist at the exact same time for the exact same synapse O it always has the same effects regardless of the concentration of neurotransmitters

Heme molecules
with iron ion
In this cartoon, the quaternary structure of hemoglobin is shown with four globin protein chains in different colors. Each of the four polypeptide chains
is called a
in the context of the multi-chain complex
Submit Answer
Try A

Biology

Biomolecules Solutions

Heme molecules with iron ion In this cartoon, the quaternary structure of hemoglobin is shown with four globin protein chains in different colors. Each of the four polypeptide chains is called a in the context of the multi-chain complex Submit Answer Try Another Version 10 ltem attempts remaining

2 PLS
Why is PBP2a a major problem? Check all that apply
It doesn't bind to penicillin
It is encoded on a plasmid
It is encoded on a chromosome
It confers resistance to methicillin
Question 73
1 pts
Tetracycline-resistant ribosomal protection protein, tet(

Biology

Biomolecules Solutions

2 PLS Why is PBP2a a major problem? Check all that apply It doesn't bind to penicillin It is encoded on a plasmid It is encoded on a chromosome It confers resistance to methicillin Question 73 1 pts Tetracycline-resistant ribosomal protection protein, tet(O), binds to the bacterial ribosome leading to conformational changes that prevent tetracycline binding to its target even after tet(O) dissociates. O True O False

2
1 pts
What is a TRUE statement about "trans-unsaturated" fatty acid tails?
Trans-unsaturated fatty acid chains contain carbon double bonds, while cis-unsaturated fatty acid chains do
not.
Trans unsaturated fatty acid chains contain carbon double bonds, b

Biology

Biomolecules Solutions

2 1 pts What is a TRUE statement about "trans-unsaturated" fatty acid tails? Trans-unsaturated fatty acid chains contain carbon double bonds, while cis-unsaturated fatty acid chains do not. Trans unsaturated fatty acid chains contain carbon double bonds, but the chains contain kinks and are difficult to pack tightly together. Trans-unsaturated fatty acid chains contain carbon double bonds, but the chains are linear and pack together tightly similarly to how saturated fatty acid tails do. Trans unsaturated fatty acids chains do not contain any carbon double bonds. That is why the chains are inear and pack tightly together.

Which statement below concerning a peptide bond and polypeptides is NOT true?
A polypeptide can be thought of as a series of amide planes with rotation points with respect to each other at the a-carbons.
There is limited rotation about the w bond angle.
Th

Biology

Biomolecules Solutions

Which statement below concerning a peptide bond and polypeptides is NOT true? A polypeptide can be thought of as a series of amide planes with rotation points with respect to each other at the a-carbons. There is limited rotation about the w bond angle. The fangle describes rotation about the bond between an a-carbon and the amide nitrogen of the backbone. Because of the partial double characteristics, the atoms of the peptide group are in a single plane. The four atoms of the peptide group form an amide plane,

Which of the following is a basic cellular pathway that is also used as a strategy by the immune system to
monitor for proteins made in almost any cell in the body?
o the use of calnexin as a chaperone
the use of ubiquitin ligases to create scaffolds
o the

Biology

Biomolecules Solutions

Which of the following is a basic cellular pathway that is also used as a strategy by the immune system to monitor for proteins made in almost any cell in the body? o the use of calnexin as a chaperone the use of ubiquitin ligases to create scaffolds o the use of immunoproteasomes to generate peptides O the use of ubiquitin tagging and prateasames for protein turnover or recycling O the use of proteolytic enzymes in endocytic vesicles

Get homework help from verified tutors

Create account for free to start getting homework help from real tutors 24/7

SIGN-UP AND TRY IT FREE