Biomolecules Questions

If most chemical reactions are reversible, how do pathways like cellular respiration not run backwards?
a) One product is needed before the next reactant is made.
b) Enzymes are only active when needed.
c) One reactant is needed before the next produ

Biology

Biomolecules Solutions

If most chemical reactions are reversible, how do pathways like cellular respiration not run backwards? a) One product is needed before the next reactant is made. b) Enzymes are only active when needed. c) One reactant is needed before the next product is made. d) Enzymes are only produced in certain organelles.

Enzymes, which are made of ________ will ________ the activation energy needed for a reaction to occur.

Biology

Biomolecules Solutions

Enzymes, which are made of ________ will ________ the activation energy needed for a reaction to occur.

2. A zebra mussel is discovered in a lake in Pennsylvania for the first time. Why would this make an ecologist worried?
O A. Zebra mussels are an invasive species that can completely disrupt an ecosystem.
B. Zebra mussols are vulnerable to many predators i

Biology

Biomolecules Solutions

2. A zebra mussel is discovered in a lake in Pennsylvania for the first time. Why would this make an ecologist worried? O A. Zebra mussels are an invasive species that can completely disrupt an ecosystem. B. Zebra mussols are vulnerable to many predators in that lake. C. Zebra mussels need to live in salt-water environments and it will hurt the organism. O D. Zebra mussels need to live in hot-water environments.

3
Unlike minerals such as iron and calcium, protein is a macronutrient in the human diet. Why is protein a macronutrient?
OA.
The human diet requires a relatively large amount of protein.
OB.
Proteins are one of the few inorganic compounds that humans eat.

Biology

Biomolecules Solutions

3 Unlike minerals such as iron and calcium, protein is a macronutrient in the human diet. Why is protein a macronutrient? OA. The human diet requires a relatively large amount of protein. OB. Proteins are one of the few inorganic compounds that humans eat. O c. Proteins are the most calorie-dense molecules that humans eat. OD. The human diet should be made up of mostly protein. Reset Next

In the salvage of purines, hypoxanthine-guanine phosphoribosyltransferase (HGPRT) is responsible for which of the following processes?
A) Conversion of hypoxanthine to xanthine.
B) Conversion of guanine to guanosine monophosphate (GMP).
C) Conversion

Biology

Biomolecules Solutions

In the salvage of purines, hypoxanthine-guanine phosphoribosyltransferase (HGPRT) is responsible for which of the following processes? A) Conversion of hypoxanthine to xanthine. B) Conversion of guanine to guanosine monophosphate (GMP). C) Conversion of adenine to adenosine monophosphate (AMP). D) Conversion of inosine monophosphate to inosine.

All are reasons to monitor therapeutic drugs EXCEPT:
A) serious consequences from overdosing.
B) unpredictable blood levels.
C) monitor patient compliance.
D) large difference between therapeutic and toxic dose.

Biology

Biomolecules Solutions

All are reasons to monitor therapeutic drugs EXCEPT: A) serious consequences from overdosing. B) unpredictable blood levels. C) monitor patient compliance. D) large difference between therapeutic and toxic dose.

How are fatty acids transported to the cells for B-oxidation?
A. they are carried by albumin
B. they are transported in LDL particles
C. they are only degraded in the liver and are not transported
D. they are bound to and carried by carnitine
E. they

Biology

Biomolecules Solutions

How are fatty acids transported to the cells for B-oxidation? A. they are carried by albumin B. they are transported in LDL particles C. they are only degraded in the liver and are not transported D. they are bound to and carried by carnitine E. they are bound to and carried by a CoA molecule

Hector is back from his morning run and is feeling lightheaded because his energy is depleted. Which food item will provide him with a quick source of carbohydrates?
A. fruit juice
B. Tuna fish
C. scrambled eggs and butter
D. beans

Biology

Biomolecules Solutions

Hector is back from his morning run and is feeling lightheaded because his energy is depleted. Which food item will provide him with a quick source of carbohydrates? A. fruit juice B. Tuna fish C. scrambled eggs and butter D. beans

What is the purpose of this section of text?
A. To contrast how different people used sugar
B. To explain sugar cane's ceremonial purpose
C. To compare sugar cane use to honey use
D. To provide the history of sugar cane use

Biology

Biomolecules Solutions

What is the purpose of this section of text? A. To contrast how different people used sugar B. To explain sugar cane's ceremonial purpose C. To compare sugar cane use to honey use D. To provide the history of sugar cane use

Transcription and Translation
Practice Worksheet
Example:
DNA:
GTACGCGTATACCGACATTC
mRNA:
CAUGCGCAUAUGG CUGUAAG
Codons:
AUG-CGC-AUA-UGG-CUG-UAA
Anticodons: UAC-GCG-UAU-ACC-GAC-AUU
Amino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINE
Using the exa

Biology

Biomolecules Solutions

Transcription and Translation Practice Worksheet Example: DNA: GTACGCGTATACCGACATTC mRNA: CAUGCGCAUAUGG CUGUAAG Codons: AUG-CGC-AUA-UGG-CUG-UAA Anticodons: UAC-GCG-UAU-ACC-GAC-AUU Amino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINE Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: ATACGA AATCGCGATCGCGGCGATTCGG 1. mRNA: UAGC LUUAGGECUAGCGCCGCUAAGCC Codon: GU Anticodon: Amino Acids: 2. DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids:

Which of these best describes a partial agonist?
O its effects differ depending on the concentration
of the neurotransmitter in question
O it acts as both an agonist and an antagonist at the
exact same time for the exact same synapse
O it always has the sa

Biology

Biomolecules Solutions

Which of these best describes a partial agonist? O its effects differ depending on the concentration of the neurotransmitter in question O it acts as both an agonist and an antagonist at the exact same time for the exact same synapse O it always has the same effects regardless of the concentration of neurotransmitters

Heme molecules
with iron ion
In this cartoon, the quaternary structure of hemoglobin is shown with four globin protein chains in different colors. Each of the four polypeptide chains
is called a
in the context of the multi-chain complex
Submit Answer
Try A

Biology

Biomolecules Solutions

Heme molecules with iron ion In this cartoon, the quaternary structure of hemoglobin is shown with four globin protein chains in different colors. Each of the four polypeptide chains is called a in the context of the multi-chain complex Submit Answer Try Another Version 10 ltem attempts remaining

Get homework help from verified tutors

Create account for free to start getting homework help from real tutors 24/7

SIGN-UP AND TRY IT FREE