Respiratory System Questions and Answers

I point The nose serves all of the following functions EXCEPT O O O O Cleansing the air As the direct initiator of the cough reflex Warming and humidifying the air As a passageway for air movement 14 1 point Which of the following statements is correct Bronchioles have more smooth muscle in their walls than bronchi Bronchioles have more cilia lining them than bronchi Bronchioles are supported by cartilage rings Bronchi are supported by elastic fibers

What is the name of the nerve

The influence of blood vessel diameter on peripheral resistance is The only factor that influences resistance Significant because resistance is inversely proportional to the fourth power of the vessel radius Insignificant because vessel diameter does not vary Significant because resistance is directly proportional to blood vessel diameter 6 1 point Factors that aid venous return include all except 7 1 point Which of the following statements is correct 0000 Urinary output Pressure changes in the thorax Activity of skeletal muscles Venous valves 000 Hydrostatic pressure will drop as blood moves away from the arteriole end of the capillary bed Hydrostatic pressure will rise as blood moves away from the arteriole end of the capillary bed Hydrostatic pressure will remain constant throughout the capillary bed Osmotic pressure will be lower in the arteriole end of the capillary bed compared to the 8 1 point The velocity and pressure of blood is slowest and lowest in the capillary beds Which of the following is not an accurate description of the I slow low pressure blood in the capillary beds Lower pressure reduces the chance of injury to delicate capillary vessels Lower pressure on the venous end of the capillary bed allows for greater reabsorption of fluid back to the plasma bed helps to increase pressure in the venous circulation

10 COB Scientific 11 12 13

Secondary bronchi supply air to the lobes of the lungs lobules of the lungs O a O b O c lungs O d alveoli

Vital capacity is sum of O a Inspiratory reserve volume tidal volume and expiratory reserve volume O b Residual volume inspiratory volume and expiratory volume O c Tidal volume Inspiratory reserve volume and residual volume Od Expiratory reserve volume inspiratory reserve volume and residual volume

The accessory muscles of inhalation include O a Diaphragm Ob Internal intercostals OC Sternocleidomastoid O d External intercostals

The main function of surfactant is Reduce alveolar pressure O b Increase alveolar pressure OC Increase surface tension of alveolar fluid d Reduce surface tension of alveolar fluid S C P Categ P D P P

Which of the following lung volumes is not measured by spirometry O a Residual volume O b Tidal volume Oc Expiratory reserve volume Od Inspiratory reserve volume

Which of the following lung volumes is not measured by spirometry O a Inspiratory reserve volume O b Expiratory reserve volume Tidal volume O d Residual volume

When DNA sequences are used for phylogenetic analyses each nucleotide position can be considered a trait Using the data provided below 57 bases from the mitochondrial DNA sequences of three chameleons and one lizard map ONLY the synapomorphic traits onto the phylogenetic tree provided below Note the horizontal branch on the tree where each trait transition takes place by using a line and the number of the base base numbers can be determined using the 10 50 marks above the sequence As an example of how I want you to map the traits onto the tree I have chosen a trait that is NOT synapomorphic and mapped it onto the tree position 10 the trait in question is an A in the lizard and two species of Brookesia and transitions to G in Chamaeleo After mapping all of the synapomorphic traits count the total number of trait transitions required to support this tree and note this number next to your tree If you are not sure which traits are synapomorphic read the material in the tan box that starts on page 214 of the text and is entitled Phylogenies from DNA sequences NOTE the tree only shows the three chameleon species leaving out the lizard Uromastyx outgroup that is included in the DNA data so you can evaluate which base is ancestral for each position Uromastyx B theili B brygooi C feae 10 20 1 30 40 50 AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT Brookesia theili Brookesia brygooi

Match the viral structures with functions as you did for Part I What is a virus protects the viral particle from immune recognition and is involved in attachment to the host cell may be RNA or DNA single or double stranded blueprint for new viral particles 0 Made of proteins protects the viral genome Attachment and entry into host cell 1 Protein Capsid 2 Envelope Glycoprotein 3 Lipid Envelope 4 Viral Genome

introductory paragraph Summer is here at last a time when many people are happily stepping out to enjoy the fresh air and sunshine However there is a cloud on the horizon There is another cloud in front of that doorway and yet another cloud hovering around an outdoor caf Unfortunately these clouds are not natural they are the result of a personal habit that negatively impacts others With cigarette smoke in the air people cannot enjoy the scent of flowers and freshly cut grass With cigarette butts littering streets and parks children can no longer run barefoot through the grass It is time to ban smoking in all outdoor public spaces What is the main function of the sentence Unfortunately these clouds are not natural they are the result of a personal habit that negatively impacts others in the paragraph O It introduces the topic provides background information O It presents the thesis O It helps set the tone It hooks the reader

Match the item to its function 1 Smooth muscle Click to select v 2 Transitional epithelium Click to select 3 Cartilage Click to select 4 Neuron Click to select 5 Keratinized stratified squamous epithelium Click to select Click to select Communication Distention of the urinary bladder Protection of joint surfaces in movable joints Protection and waterproofing Peristalsis of the esophagus

Marge is 72 and has been rushed to the hospital She s unable to move the left side of her body and she s having trouble speaking Which term best applies to this situation O chronic obstructive pulmonary disease Oglaucoma O diabetes O cerebral vascular accident

The is the to A I E inspiration time expiration time 3 to 4 B I E inspiration time expiration 1 to 3 C V Q Ventilation Quotient 6 of 7 D V Q Volume Perfusion 5 to 6 E I E inspiration time expiration 2 to 3

20 The main muscle for breathing is the A External intercostal B Internal intercostal C Scalene D Diaphragm

from the involves inhaling is transported to the and enters the blood in the A External respiration CO2 atmosphere O2 CO2 alveoli pulmonary veins B External respiration O2 atmosphere CO2 O2 alveoli pulmonary capillaries C Internal respiration O2 atmosphere CO2 O2 alveoli pulmonary capillaries D Internal respiration NO tissues CO2 NO bronchus pulmonary arteries E None of the above and exhaling 6 The inhal

Kussmaul respirations deep and fast non voluntary breathing pattern are a manifestation of Same question asked another way what are Kussmaul respirations trying to compensate for macro vascular complications HHS hypoglycemia

Which of the following correctly describes the pathway of lymph Lymphatic vessels to lymphatic trunks to lymphatic ducts to lymphatic capillaries O Lymphatic ducts to tymphatic trunks to lymphatic vessels to lymphatic capillaries Lymphatic capillaries to lymphatic vessels to lymphatic trunks to lymphatic ducts Lymphatic ducts to lymphatic capillaries to lymphatic vessels to lymphatic trunks

Which of the following is NOT a method that maintains lymph flow Breathing O Capillary smooth muscle contraction Skeletal muscle contraction Valves in lymph vessel walls

Intrapleural pressure is normally about 4mm Hg less than the pressure in the alveoli True False

Lymphoid tissue is mainly reticular connective tissue O True False

Question 8 What category of drugs is most commonly used in the treatment of COPD anticholergies antibiotics Incorrect Antibiotics are drugs used to prevent or stop bacterial infections antivirals

asal discharge is frequ seen in infection and asthma infection and inflammation asthma and acute bronchitis inflammation and acute bronchitis Incorrect Nasal discharge is not frequently seen in acute bronchitis

A cold progresses through the stages of inoculation incubation full blown illness and recovery This is known as the cold s process i prognosis Incorrect A prognosis is the expected outcome of the disease or condition etiology Opathogenesis

Which disease is known for its potential to become chronic Influenza Malaria Tuberculosis

Most acute diseases are related to what a syndrome Incorrect A syndrome does not have a sudden onset nor last a short amount of time cancer the respiratory system

What type of diagnostic test measures the amounts of carbon dioxide and oxygen in the blood arterial blood gases pulmonary function tests alpha 1 antitrypsis level Incorrect The blood test checking for alpha 1 antitrypsis AAT level is a genetic test for risk factors of COPD

A friend tells the nurse that she went to the nurse practitioner and was diagnosed with a head cold What is the most likely causative organism mycobacterium tuberculosis streptococcus pyogenes rhinovirus influenza A

Given an RER of 0 85 how many kcals are expended per liter of O consumption Enter an answer to two 2 decimal points e g x 12

Iwhat are the social determinants

O True O False Question 9 1 True or False In the 2010 U S Census Some Other Race represented the third largest race group primarily because almost half of Hispanic or Latino respondents c not identify within any of the racial categories as defined in the U S Census True

the first stage of a plot development in any works of fiction in which the author elaborates on the conflict and builds toward a climax the second stage of a plot development in any works of fiction in which the author elaborates on the conflict and builds toward a climax the second stage of a plot development in any works of fiction in which the author elaborates on the conflict and builds toward resolution the final stage of a plot development in any works of fiction in which the author elaborates on the conflict and builds toward a climax Qu 5 9

Panic attacks are codeable O True O False

8 During inspiration what two portions of the brain send nerve impulses to the diaphragm O Pons and Corpus Callosum O Pons and Brain Stam O Pons and Medulla Medula and Brain Stom Medula and Thalamus

24 If blood carbon dioxide concentrations got too high oxyhemoglobin would release O Nitrogen O Red Blood Cells O White Blood Cells Oxygen Albumins

Carbohydrates and Proteins contain 4 calories per gram True False

35 The larynx connects the nasal cavity to the epiglottis O True O False 36 The body creates respiration through the action of hematopoiesis O True False

11 When a cell swells because of a difference in osmotic pressures to the cell s surroundings the ECF is said to be isotonic hypotonic or hypertonic 12 Adding water to a cell s surroundings makes the extracellular environment more isotonic hypotonic or hyperosmotic than the intracellular environment 13 If the extracellular environment is more dilute than the intracellular environment water moves into or out of the cell 14 If the extracellular environment becomes more dilute that means that there is a higher or lower concentration percentage of sodium in the extracellular fluid

85 Scarring patches injuries and never harms the body O True O False 86 Functions of muscles include O Skeletal movement O Posture support Beating of the heart Movement of food O O All of the above 87 The two lateral processes on a vertebrae are called transverse processes O True False

2 The muscle used to contract and relax for breathing is the O Diaphragm O Lungs Trachea O Thorax

1 2 3 5 6 Which of the following is It is a firm flexible tube DIFEY WINE O It carries food to the stomach O It s surrounded by muscle O Moves oxygen directly into bloodstream O Is more than 10 inches long 7 8 10 11

The left primary bronchus is indicated by the letter O A OB O C B A D Sydney Roth

2 Chronic Obstructive Pulmonary Disease COPD is a progressive lung condition in which lung tissue is damaged primarily by long term inhalation of harmful particles chemicals or gases This results in inflammation and narrowing of the airways a breakdown of the lung tissue and in some cases replacement of damaged lung tissue with fibrous scar tissue Patients often have difficulty exhaling and retain excess air in the lungs even after full exhalation leaving less room for air during inhalation and causing enlargement of the thorax Based on the information gathered above identify the individual who likely has COPD Explain how the information and results of the spirometry testing support this decision

4 Asthma is a chronic disease condition characterized by inflammation and muscular spasms of the tiny airways i e bronchioles Although the inflammation is almost always present the muscular spasms come unpredictably causing the airways to constrict and interfering with air movement in and out of the lungs Based on the information gathered above identify the individual who likely has asthma Explain how the information and results of the spirometry testing support this decision

Question 4 Blood poor in oxygen Points 2 Blood rich in oxygen Wall of air sac 1 2 Wall of blood vessel During respiration which of the following mechanisms occurs O CO from the blood is released while oxygen is taken in O Oxygen from the blood is released while CO is taken in CO and oxygen from the blood is released while H O is taken in H O from the blood is released whil

14 On the cristae of the mitochondria there are groups of proteins many are called and this group is known as the Vcytochromes

What are the effectors involved in the control of pulmonary ventilation the answer is not one word

11 Ultimately what happens to the carbon atoms of pyruvic acid Where do they go